You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
yomQ [2018-11-19 17:58:22]
Genomic Context
categories
[category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage][category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]Gene
Coordinates
2,243,642 → 2,243,992
The protein
Protein family
trpC family (according to Swiss-Prot)Expression and Regulation
additional information
translation is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]Biological materials
Mutant
BKE21260 (Δ[gene|74137B4DA75E9AD374356DE0AE05F3E7BFC751FF|yomQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGACTTACCTCCTAATTC, downstream forward: _UP4_GCATGAGCAATTTTTGGGTTBKK21260 (Δ[gene|74137B4DA75E9AD374356DE0AE05F3E7BFC751FF|yomQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGACTTACCTCCTAATTC, downstream forward: _UP4_GCATGAGCAATTTTTGGGTT